Analogies and Homologies

Homologous Traits

A homologous trait is one that is shared between two different species descendent from an ancestor and sharing genetic traits.

An example of two different species who share a homologous trait is the domesticated horse and the South American tapir.  The quarter horse has a medium to large size body with a long head and neck and has a mane.  They have slender legs which end in a single toe covered by a horny hoof.  They have long tails made entirely of hair and are adaptable to savannas, plains, mountains and desert environments.  Horses reach weights of upwards of 1,500 lbs and heights of 5-6 feet.  Horses are built for speed and have a highly developed sense of flight or fright to escape from predators.

The tapir is a medium to large animal resembling a pig.  They are grazing and browsing mammals having a stockier more compact body.  They have oval, white-tipped ears and protruding rumps with short stubby tails.   The tapir can weigh in upwards of 700 lbs, but is a very short animal reaching only about 3-4 feet in height.  Tapir’s have splayed hoofs with 4 toes on the front feet and 3 toes on the back.  Its environment is in forests mainly in South America and Asia.  They can submerge under water and spend a good deal of time near water sources.

One homologous trait of both animals is that they both have hoofs on all four of their limbs.  The horse’s hoof is a horny covering of a single toe at the end of each of its four limbs.  The tapir’s hoofs cover four toes on the front feet and three toes on the back feet.  Both the horse’s and tapir’s hoofs developed to better be able to carry the greater weight of their bodies.  However the horse’s hoofs ending in a single toe and horny hoof covering have a more singular function for harder ground more suited to the plains, rocky mountains, deserts and savannas.  The tapir’s hoofs still possess the 4-toe and 3-toe appendages, which enable it to maneuver more ideally in the muddy, forested environments of South America and Asia.  Both animals are descendent of the perissodactyla order on a cladogram graph, but are very distinct and different species today.  A common ancestor was the now extinct Chalicotherium, a grazing odd-toed ungulate of the perissodactyla.  

Analogous Traits

An analogous trait is one that is shared by two species but cannot be traced back to a common ancestor and therefore evolved independently.

The rhinoceros is a large animal weighing up to one ton with thick skin and eating an herbivorous diet.  They have a horn on the snout and can be found in Africa and India.  Although quite large, they are actually built for great speed and quickness and related more closely to the horse.   

The antelope is a medium sized bovine species found in Africa and Asia.  They are distinguished by two pronged horns growing from the top of the skull.  They are even-toed bearing weight on their third and fourth digits.  They are herbivores with quick speed and jumping skills. 

Both the rhinoceros and the antelope share the analogous trait of having horns.  The horns on both mammals serve a similar purpose of protecting the animal when in danger from a predator, although the rhinoceros does not have many known predators.  As the antelope and rhinoceros do not have a common known ancestor, it is more likely that both species developed the appendage of the horn feature independently of each other.  The rhinoceros is from Eutheria infraclass and the Perissodactyla order and the antelope is from the Artiodactyla order and Ruminantiamorpha clade.  There are differences in the horns of both animals.  They differ in make up as the antelope horn is made up of bone protruding from the animals skull, while the rhinoceros horn is made more from a fingernail-like material and not of bone.  

While these two species evolved the development of horns separately, further back in time, they may have come from a common ancestor as both are in the class of mammals who are herbivores and have hooved feet.  While their ancient ancestor may have had the same number of toes, these species may have developed separately due to isolation and other natural selection factors to develop the variance in the number of digits they show today.  The antelope is an even-toed mammal, while the rhinoceros is an odd-toed mammal.

Protein Synthesis DNA Code

Following is a DNA string of code to decipher and find my sentence.  Happy hunting!

  GTGCGTACCAAGATGTTACGTGCAGTATTCTGTCAGTCTGAAAATTTATCTGGA

Historical Influences on Darwin

There were many scientists in Darwin’s time who influenced his development of the theory of evolution.  Charles Lyell, however had more influence in inspiring and shaping the overall ideas and timeline of the theory of evolution than any other contemporary of Darwin.

Charles Lyell was a geologist who believed in “geological uniformitarianism”, which was the belief in gradual, slow and methodical changes to the earth over thousands of years.    (http://evolution.berkeley.edu/evolibrary/article/_0/history_12).  Lyell believed that the face of the earth’s topography had been developed through subtle changes due to “wind, water erosion, flooding, frost, decomposed vegetable matter, volcanoes, earthquakes and glacial movements.” (Physical Anthropology, p. 31)   This idea of gradual and very slow changes to the geology of the earth made the earth much older than previously thought, according to his theories.  His idea of this new longer time line was in great contradiction to the current accepted idea of creationism, which focused on more catastrophic events such as those related in the Bible,  and created much debate in the scientific community regarding the age of the earth. 

Lyell’s work heavily influenced Darwin’s train of thought.  As Darwin studied and applied this new longer time line to his theory of evolution in the world of biology, he was able to determine that the changes he saw in plants and animals were made over more gradual periods of time.  This led him to the conclusion that individuals do not evolve during their lifetimes, but rather populations evolve over generations.  Evolution occurring between generations is a major component to the theory of evolution and a direct result of Lyell’s work in geology and theory of uniformitarianism.

Without Charles Lyell’s influence, it is doubtful that Darwin would have been able to complete his work.  It was during Darwin’s 5 year voyage aboard the Beagle that he studied Lyell’s works and theories and became inspired by the varied species of life he encountered and yet could not explain without the application of Lyell’s theories.  Darwin and Lyell were also friends and colleagues.  While Darwin was reluctant to publish his findings, Lyell was a constant encouragement.  It was eventually at Lyell’s urging that Darwin published The Origin of Species and presented his work to the rest of the world.

 

While Darwin was ever more convinced of the theory of evolution, he was also conflicted about his findings due to the vast influence of the Church and his own beliefs that he was brought up with.  He was a well respected man from an educated and respected family and well aware of other scientists whose reputations had been undone when their published works were contradictory to biblical accounts supported by the Church.  Darwin was also a large supporter of the church and gave charitably of his time and money to his local parish in Downs.  (http://www.darwinproject.ac.uk/darwin-and-the-church-article)  His conflict, both with the views of his spouse (who was very religious) and the Church, was the main reason that he delayed publishing The Origin of Species as long as he did.  His overwhelming and continued evidence of his scientific findings, however and the added evidence of his contemporary, Russell Wallace, who was also independently developing the idea of natural selection in evolution, eventually convinced him to publish his work and the theory of evolution.